Twenty Macrophomina phaseolina isolates isolated from diseased chickpea plants collected from major chickpea growing states of India and were subjected for morphological and molecular characterization in this study during the year 2014 at Gandhi Krishi Vignan Kendra (GKVK) Bangalore. Variability in morphological characters like mean diameter of microsclerotia, number of microsclerotial bodies produced, shape and size of microsclerotia is observed among the isolates. All the pathogen isolates which causing dry root rot in chickpea were identified as Macrophomina phaseolina with species specific primers MpKFI (5’CCGCCAGAGGACTATCAAAC 3’) and MpKRI (5’ CGTCCGAAGCGAGGTGTATT 3’) and molecular characterization done by employing Internal Transcribed Spacer (ITS) region sequence and PCR-RAPD. Among both the markers used for the study RAPD helps to know only variability but ITS region sequence was found best to identify the pathogen and to study the variability at molecular level among the twenty isolates

Babesiosis is a common problem in canine population causes frustration among pet owner and veterinarians. It is a tick born hemoprotozoan disease affecting vast variety of canine breed of almost all age group. Life cycle include only intraerythrocytic stage known as merozoite which are basically daughter parasite. Clinical signs consist of high-grade fever, anaemia, jaundice, haemoglobinuria etc. Diagnosis by conventional method is most common in practice although serological and molecular diagnosis can also be available especially for carrier animals and for subclinical disease. Therapeutic management include drug and drug combinations with positive outcome. Common drugs used as a first line of treatment are Diminazene aceturate and Imidocarb dipropionate although different combination of drugs like atovaquone and azithromycin, buparvaquone and azithromycin or clindamycin (CLDM), metronidazole (MNZ) and doxycycline has been successfully used against canine babesiosis. Supportive therapy includes blood transfusion, fluid and electrolyte therapy, corticosteroids and immunomodulators. Control of tick population, vaccination, safe blood transfusion, avoiding dog fitting are key to control the babesiosis in canine population

India is an agriculture-dominant country. Most of the Indian population depends on agriculture and allied occupation. A huge market for Agri-inputs exists in India. Earlier, farmers used to purchase Agri-inputs from an Agro retail shop or cooperative societies. In the era of digitization, some Agri-input companies have started electronic retailing of Agri-inputs, wherein farmers can order from the website or by phone call and Agri-inputs are delivered to their doorstep. The present Empirical Research Paper highlights the awareness and expectations of farmers for e-Retailing of Agri-inputs in south Gujarat. The research was conducted in three randomly selected districts of Gujarat. 300 respondent farmers were selected purposively by adopting a multistage sampling technique. Required data were collected by using a pre-coded interview schedule and analyzed considering the objectives of the study. The result of the study indicates that farmers were expected for timely delivery, good quality of product, availability of different sizes of the packaging, a good amount of discount and after-sale service from e-Retailers of Agri-inputs. If appropriate remedial measures are taken by the Agri-input companies, the trend of e-Retailing of Agri-inputs will surely pick up momentum in the future in the state of Gujarat

The investigation on the effect of drip irrigation using treated paperboard factory effluent and on groundwater quality under banana cultivation was carried out at the ITC Ltd, Thekkampatti village, (Mettupalayam taluka) located in Coimbatore district of Tamil Nadu. A Randomized block design was adopted to conduct the experiment with three replications. River water and treated effluent were irrigated through a drip irrigation system and through traditional surface irrigation along with half and three fourth of the recommended dose of NK fertilizers. Drip and surface irrigation treatments were compared with farmer’s practice (surface irrigation of river water with 100% recommended NPK, plant–1y-1) (Recommended dose was 110:35:330 g of NPK plant–1 y-1). All treatments uniformly received the recommended dose of P applied as a basal dressing in the pit before planting the suckers. Monitoring wells were installed at the canter of each plot. Water samples collected from the piezometers installed in the plot of respective treatments indicated that the groundwater quality parameters viz., BOD, COD, EC, TDS, Na, K, Cl, SO?, NO? contents and SSP values were low in drip irrigation treatments while the above contents were higher due to basin irrigation of treated board factory effluent. Hence it is recommended to adopt drip irrigation for recycling treated paper board factory effluent for the banana to protect the wells from contamination in and around ITC limited paper board factory

Sweet pepper is commonly known as capsicum, bell pepper and Shimla mirchi. Under protected cultivation widely grown due to higher productivity and economic feasibility. Diseases of viral nature affect the crop production significantly both in terms of yield and quality. To know the incidence of viral diseases and prevalence of vector population fourteen capsicum hybrids were screened during kharif 2018 and rabi 2018-19. None of the hybrids were found to be resistant during the both the seasons. However, During kharif 2018, six hybrids viz., Maxibell, Shristika, SV1865PB, Asha, Arka Gaurav and Arka Basanti were found to be moderately susceptible for leaf curl disease and for mild mottle disease, hybrids Arka Gaurav and Arka Basanti recorded moderately resistant reaction. Results of rabi 2018-19 season revealed that, hybrids Shristika, SV1865PB, Asha, Indra, Arka Gaurav, Arka Basanti, 35-160-R2 and NSX 8 found to be moderately susceptible for mosaic disease. The symptoms observed during screening included mosaic and mottling, yellow discoloration, vein clearing, leaf deformation and narrowing, stunted plant growth, reduced fruit setting and light green colour mottling symptoms on fruits

Front line demonstrations (FLD) were conducted by Krishi Vigyan Kendra, Sadalpur, Hisar to compare the gap between demonstrated field and farmer practices (FP) under irrigated semi arid condition of Haryana. It was found that yield of chickpea was higher in demonstration field as compared with farmer practices during 2018-19. The average yield of chickpea was recorded 19.5 q/ha where as in farmer practices it was observed 16.40q/ha. The average technology gap, extension gap and technology index was recorded6.50, 3.10 and 25.0percent during 2018-19 respectively. The cost benefit ratio (B:C) was obtained better in demonstrated field than farmer practices. The gap between demonstration field and farmer practices may be due to the farmers were not applied the latest technology in production of chickpea as mentioned in package of practices from seed treatment to final maturity of crop

A field experiment was planned and conducted during the Rabi season of 2019-2020 at Crop Research Center of Alpine Institute of Management and Technology, Dehradun, Uttarakhand. The experiment was conducted to evaluate the effect of organic and inorganic fertilizers on productivity of lentil (Lens esculenta Moench). The experiment was laid out in randomized block design with three replications and ten treatments. The treatments constituted viz. T1- control, T2- RDF, T3- FYM, T4- vermicompost, T5- RDF + FYM, T6- RDF + vermicompost, T7- Rhizobium + PSB, T8 RDF + Rhizobium + PSB, T9- FYM + Rhizobium + PSB and T10- vermicompost + Rhizobium + PSB. The crop variety Pant Masoor- 5 was sown on October 20, 2019 and harvested on March 01, 2020. Studies were made on growth parameters (plant height, number of branches and dry weight per plant), root nodulation, yield attributing parameters (number of pods per plant, number of seeds per pod and 100 grain weight), productivity parameters (grain yield and straw yield) and economical returns. It was concluded from the findings that integrated nutrient management having RDF + FYM increased the plant height, branches and dry weight per plant of lentil up to maximum. The application of RDF + FYM increased the root nodulation, yield attributing parameters and yield of lentil significantly higher to those of other treatments except RDF + vermicompost and RDF + Rhizobium + PSB. Amongst the integrated nutrient management treatments, RDF + FYM recorded the maximum net profit of Rs. 19,047 per hectare and B: C ratio of 1.72

Micropesticides, a subset of micropollutants, are nanoscale chemical compounds used in agriculture to control pests and protect crops. Despite their small size, these tiny particles possess potent pesticidal properties. This article provides an overview of micropesticides, exploring their characteristics, environmental impacts, and associated health risks. Micropesticides can contaminate soil and water, disrupting ecosystems and posing threats to non-target organisms. Human exposure to micropesticides raises concerns about potential health effects. The article also highlights the need for sustainable alternatives, such as integrated pest management and biopesticides, and the role of nanotechnology in developing safer and more targeted pesticide delivery systems. Understanding the risks and embracing sustainable practices are vital for mitigating the hidden dangers of micropesticides and ensuring a healthier and more sustainable agricultural future

The article examines the key factors contributing to environmental degradation, such as deforestation, pesticide use, and water pollution. The paper also explores the consequences of these practices on biodiversity loss, soil degradation, and greenhouse gas emissions. Furthermore, it discusses sustainable farming methods, certification programs, and initiatives aimed at mitigating the environmental impact of cocoa cultivation. The abstract concludes by emphasizing the need for a holistic approach involving farmers, industry stakeholders, and policymakers to address these environmental challenges and ensure the long-term sustainability of cocoa production

The experiment was conducted at Chaudhary Charan Singh Haryana Agricultural University, Hisar for two consecutive kharif seasons i.e., 2018-19 and 2019-20. The experimental material consisted of 150 germplasm lines of Gossypium hirsutum L. planted in augmented design with three checks (H1098i, H1226, and H1236). The categorization of germplasm lines based on DUS traits was done following all the guidelines by PPVFRA. A total of 34 traits were studied for the same and ample variation was seen among genotypes for hypocotyl pigmentation, pubescence on stem, stem pigmentation, leaf color, pigmentation of petiole, flower petal color, boll shape, prominence of tip, plant height, growth habit, seed index, ginning percentage, fiber length, fiber strength and fiber fineness. Characters like leaf shape, leaf hairiness, the position of stigma, pollen color, boll color, boll opening, boll weight, seed fuzz density and fiber maturity were seen less varied among the genotypes whereas traits viz. leaf appearance, presence of gossypol glands and leaf nectaries, bract type, anther filament coloration, boll bearing habit, boll surface, fiber color and seed fuzz color did not show any variation. All the qualitative traits were stable and uniform in both seasons, quantitative traits showed some variation as they have more environmental effects

The field experiment was conducted at ITC Green Belt Greenery situated at Thekkampatty Village, Coimbatore District to evaluate the influence of drip fertigation through treated board mill effluent on nutrient mobility and moisture availability. The results of the study revealed that the moisture content was high in the surface layer near the emitter and the salts were concentrated towards the periphery of the wetting front. The exchangeable Na below the emitter was less and increased at the periphery of the wetting front, due to its mobile nature, which in turn reduced the stress from effluent irrigation

The present study was carried out on fifteen crossbred heifers to evaluate the effect of solid state fermentation (SSF) bio-mass supplementation on nutrient digestibility, rumen parameters and microbial protein synthesis in crossbred heifers. For that, fifteen crossbred heifers were randomly divided into three group of five each based on body weight and were individually fed for the 98 days. The heifers were fed total mixed ration (TMR) without SSF (T?), TMR with 3% SSF biomass (T?) and TMR having 10% reduction in protein and energy with 3% SSF biomass (T?). The results revealed that the digestibility coefficient of DM, EE, NFE, NDF and ADF were not differ by the treatment group. However, the crude protein digestibility (%) of T? group was significantly (P<0.05) higher. The crude fibre digestibility (%) in treatment group were significantly different from each other. The rumen parameters were not affected among the groups. The microbial protein synthesis in-creased non-significantly in T? group. Hence, inclusion of SSF biomass in TMR based diet helped in improving crude pro-tein and fibre digestibility and numerically increased the microbial protein synthesis in heifers.

During the autumn season a field experiment was conducted at Assam Agricultural University, ICR Farm, Jorhat, Assam to compare three different direct seeded upland rice varieties under different integrated weed and nutrient management practices. The experiment was carried out in factorial randomized block design replicated thrice with 15 treatments involving 3 varieties; Inglongkiri, Maizubiron and Rasi adopting 5 treatments of weed and nutrient management, i.e. 20-10-10 kg/ha N-P2O5-K2O + pretilachlor @ 750 g/ha followed by grubber 30 DAS (W1), 30-15-15 kg/ha N-P2O5-K2O + pretilachlor @ 750 g/ha followed by grubber 30 DAS (W2), 10-5-5 kg/ha N-P2O5-K2O + pretilachlor @ 750 g/ha followed by grubber 30 DAS + Vermicompost @ 1 t/ha (at sowing & 30 DAS) + Sesbania (Sesbania aculeata) green mulch (up to 30 days) (W3), 10-5-5 kg/ha N-P2O5-K2O + pretilachlor @ 750 g/ha followed by grubber 30 DAS with intra-row spacing 15cm (W4), and 20-10-10 kg/ha N-P2O5-K2O + Weedy check (W5). The physico-chemical properties of soil at harvest were not significantly influenced by variety as well as weed and nutrient management practices. Application of 10-5-5 kg/ha N-P2O5-K2O, vermicompost @ 1t/ha, Sesbania green mulch, pretilachlor @ 750g a.i. /ha and grubber 30 DAS showed significantly higher soil microbial biomass carbon (323.72) at 30 DAS, significantly higher bacterial count at 75 DAS (23.07) and higher fungal count at 60 DAS (10.67), significantly higher NO3-N at 35, 55 and 70 DAS, and NH4-N at 15 DAS and 70 DAS. An increase in yields was revealed as evident by higher grain and straw yield for all the three varieties observed with pre-emergence application of pretilachlor (750 g a.i./ha) + grubber 30 days after sowing + 30-15-15 kg/ha N-P2O5-K2O