Successful conservation of fish such as Poecilia species depend on analysis of genetic signature and relations among fish species and sub species. Information about the genetic fingerprint and structure of Poecilia species needs to increase several times to enable us for conserve these economic fish in the future. Many factors have contributed to the destruction of fish habitats. Polluted water, hydroelectric dams, and other environmental changes have resulted in the eradication of natural stocks. In this study genomic DNA was extracted from fin tissues and using ten decamer oligo-nucleotides as single primers in Polymerase Chain Reaction (PCR), DNA fingerprinting, dendrogram analysis and genetic similarity matrix were estimated, revealing variations between selected ten species of Poecilia. From the analyzed spe-cies three groups that found to be 100% similar are first group of sample 1 and 2, second group of sample 3, 4, and 6 and third group of sam-ple 7 and 8. The described approach holds great promise for further analyses and gives support to biodiversity maintenance as well as for conservation of genetic resources.

Tuberculosis (TB) is a major health problem in the developing world. 9 million new cases of TB and three million deaths are reported every year around the globe. The management of tuberculosis in the regions of developing countries urgently needs an efficient diagnostic test. DevR (also called DosR) is essential for promoting long-term survival of Mycobacterium tuberculosis under low oxygen conditions in a dormant state and may be responsible for latent tuberculosis in one-third of the world's population. The similarity in sequences of DevR in Mycobacterium smegmatis and Mycobacterium tuberculosis has been already proved and hence Mycobacterium smegmatis is used as a model in present study for studying and evaluating the immunogenic properties of antigen DevR. Elimination of tuberculosis (TB) largely depends upon definitive rapid diagnosis and treatment. Widely used diagnostic methods do not qualify for use in a developing country due to lack of either desired accuracy and cost. In the present study ELISA was used to evaluate the diagnostic potential of an immuno-dominant antigen DevR from 36 BCG vaccinated and 12 non-vaccinated TB patients. 48 samples were collected from healthy control subjects. We have evaluated the diagnosis of tuberculosis, based on detection of anti-IgG antibodies in the TB patient’s sera. The mean IgG antibody levels in sera of both BCG vaccinated (n=36) and non-vaccinated (n=12) patients with tuberculosis were significantly higher compared to the healthy donors (p<0.05). The results suggest that DevR could be possible candidate biomarker for effective use in the serodiagnosis of persistant tuberculosis infections.

Background: The study was aimed to explore the association of I/D polymorphism genotypes in Angiotensin converting enzyme (ACE) gene in Rheumatoid Arthritis (RA) patients from the Pakistani population. Methodology: The intron 16 of ACE gene was amplified in 200 RA patients and 200 normal healthy individuals by using a forward (ACE-F: 5´CTGGAGACCACTCCCATCCTTTCT3´) and a reverse primer (ACE-R: 5´GATGTGGCCATCACATTCGTCAGAT3´). PCR products were directly sequenced in an ABI prism 310 Automated Sequencer (Applied Biosystem). The data was statistically analyzed through SPSS software and association was tested through Chi-square and Z-test. Results: We noticed that genotype II was most frequently occur (p <0.001) in cases as compare to our healthy controls. No significant association was analyzed between the homozygote (DD) and heterozygote (ID) genotypes and pathogenesis of RA. ACE I allele carriers were at higher risk to develop RA than those who were D carriers. An association of ACE I/D gene polymorphism was established with migratory arthritis (p >0.001). Conclusion: Our present study identified an association between ACE insertion (II) polymorphism and Rheumatoid arthritis in the Pakistani population.